Recombinant:Article Title: Determining the effects of pseudouridine incorporation on human tRNAs.
Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Recombinant DNA pETM30 expression vector Addgene Plasmid #133426 pETM11 expression vector Addgene Plasmid #108943 pFastBacHT A expression vector Invitrogen 10584027 Oligonucleotides and other sequence-based reagents GTCTCTGTGGCGCAATGGACGAGCGCGCTGGACT TCTAATCCAGAGGTTCCGGGTTCGAGTCCCGGCA GAGATG In house in vitro transcribed human tRNA Arg_TCT_4-1 GGTCCTCGTTAGTATAGTGGTGAGTATCCCCGCCT GTCACGCGGGAGACCGGGGTTCGATTCCCCGACG GGGAGCCA In house in vitro transcribed human tRNA Asp_GTC_2-1 GGCCCCATGGTGTAATGGTTAGCACTCTGGACTT TGAATCCAGCGATCCGAGTTCAAATCTCGGTGG GACCTCCA In house in vitro transcribed human tRNA Gln_TTG_3-1 GGTCCCTGGTGGTCTAGTGGCTAGGATTCGGCGC TTTCACCGCCGCGGCCCGGGTTCGATTCCCGGTC AGGGAACCA In house in vitro transcribed human tRNA Glu_TTC_4-1 12 The EMBO Journal © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent/Resource Reference or Source Identifier or Catalog Number Sodium bicarbonate, 1 M buffer soln., pH 10.0 ThermoFisher Scientific J63025.AK Chloroform Chempur CHEM*112344305-1L Triton X100 LabEmpire TRX777.100 Sodium deoxycholate Merck D6750-10G Sodium acetate VWR 0602-1KG Glycogen Merck 10901393001 BisTris HCl VWR 0715-100G [N-acryloylamino] phenyl) mercuric chloride (APM) Kind gift of Sebastian Leidel (University of Bern, Switzerland) IPTG AA Biotechnology 2003-25 Glycerol Chemland 08CL00C0724.01000 Protease K Merck P2308-10MG dNTP mix ThermoFisher Scientific R0192 ATP ThermoFisher Scientific R0441 CTP ThermoFisher Scientific R0451 GTP ThermoFisher Scientific R0461 UTP ThermoFisher Scientific R0471 Spermidine 0.1 M Merck 05292-1ML-F 5-Propargylamino-CTP-Cy5 Jena Bioscience NU-831-CY5 RNase‐free DNase I ThermoFisher Scientific 89836 RiboLock RNase Inhibitor ThermoFisher Scientific EO0382 pyrophosphatase ThermoFisher Scientific EF0221 HF buffer ThermoFisher Scientific F518L Phusion polymerase ThermoFisher Scientific R0461 T7 RNA polymerase Produced in house DMEM HG Lonza BE12-604F Trypsin-EDTA 0,25% Corning Diag-Med 25-053-CI PBS w/o Mg++ & Ca++ Lonza BE17-516F FBS EurX E5050-03 BL21 (DE3) CodonPlus-RIL competent cells ThermoFisher Scientific C600003 DH10Bac cells ThermoFisher Scientific 10361012 Hi5 insect cells ThermoFisher Scientific B85502 Sf9 (Expression Systems) insect cells ThermoFisher Scientific B82501 FuGENE® HD Transfection Reagent Promega E2311 Software PR.Panta Control software v1.4.4 NanoTemper Technologies PR-S061 AN.Control Software v1.1 NanoTemper Technologies AN-020001 OriginPro https://www.originlab.com/ OriginPro 2023 10.0.0.154 cryoSPARC Structura Biotechnology Inc. SimRNA https://genesilico.pl/software/stand-alone/simrna v3.2 Other HEK293T cells Dharmacon NucleoBond AX100 Macherey-Nagel (VWR) 740521 Dynabeads MyOne Streptavidin C1 magnetic beads ThermoFisher Scientific 65002 QUANTIFOIL® R 2/1 copper grids (200 mesh) EM Resolutions Ltd. QR21200Cu100 © The Author(s) The EMBO Journal 15 D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109.
Expressing:Article Title: Determining the effects of pseudouridine incorporation on human tRNAs.
Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Recombinant DNA pETM30 expression vector Addgene Plasmid #133426 pETM11 expression vector Addgene Plasmid #108943 pFastBacHT A expression vector Invitrogen 10584027 Oligonucleotides and other sequence-based reagents GTCTCTGTGGCGCAATGGACGAGCGCGCTGGACT TCTAATCCAGAGGTTCCGGGTTCGAGTCCCGGCA GAGATG In house in vitro transcribed human tRNA Arg_TCT_4-1 GGTCCTCGTTAGTATAGTGGTGAGTATCCCCGCCT GTCACGCGGGAGACCGGGGTTCGATTCCCCGACG GGGAGCCA In house in vitro transcribed human tRNA Asp_GTC_2-1 GGCCCCATGGTGTAATGGTTAGCACTCTGGACTT TGAATCCAGCGATCCGAGTTCAAATCTCGGTGG GACCTCCA In house in vitro transcribed human tRNA Gln_TTG_3-1 GGTCCCTGGTGGTCTAGTGGCTAGGATTCGGCGC TTTCACCGCCGCGGCCCGGGTTCGATTCCCGGTC AGGGAACCA In house in vitro transcribed human tRNA Glu_TTC_4-1 12 The EMBO Journal © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent/Resource Reference or Source Identifier or Catalog Number Sodium bicarbonate, 1 M buffer soln., pH 10.0 ThermoFisher Scientific J63025.AK Chloroform Chempur CHEM*112344305-1L Triton X100 LabEmpire TRX777.100 Sodium deoxycholate Merck D6750-10G Sodium acetate VWR 0602-1KG Glycogen Merck 10901393001 BisTris HCl VWR 0715-100G [N-acryloylamino] phenyl) mercuric chloride (APM) Kind gift of Sebastian Leidel (University of Bern, Switzerland) IPTG AA Biotechnology 2003-25 Glycerol Chemland 08CL00C0724.01000 Protease K Merck P2308-10MG dNTP mix ThermoFisher Scientific R0192 ATP ThermoFisher Scientific R0441 CTP ThermoFisher Scientific R0451 GTP ThermoFisher Scientific R0461 UTP ThermoFisher Scientific R0471 Spermidine 0.1 M Merck 05292-1ML-F 5-Propargylamino-CTP-Cy5 Jena Bioscience NU-831-CY5 RNase‐free DNase I ThermoFisher Scientific 89836 RiboLock RNase Inhibitor ThermoFisher Scientific EO0382 pyrophosphatase ThermoFisher Scientific EF0221 HF buffer ThermoFisher Scientific F518L Phusion polymerase ThermoFisher Scientific R0461 T7 RNA polymerase Produced in house DMEM HG Lonza BE12-604F Trypsin-EDTA 0,25% Corning Diag-Med 25-053-CI PBS w/o Mg++ & Ca++ Lonza BE17-516F FBS EurX E5050-03 BL21 (DE3) CodonPlus-RIL competent cells ThermoFisher Scientific C600003 DH10Bac cells ThermoFisher Scientific 10361012 Hi5 insect cells ThermoFisher Scientific B85502 Sf9 (Expression Systems) insect cells ThermoFisher Scientific B82501 FuGENE® HD Transfection Reagent Promega E2311 Software PR.Panta Control software v1.4.4 NanoTemper Technologies PR-S061 AN.Control Software v1.1 NanoTemper Technologies AN-020001 OriginPro https://www.originlab.com/ OriginPro 2023 10.0.0.154 cryoSPARC Structura Biotechnology Inc. SimRNA https://genesilico.pl/software/stand-alone/simrna v3.2 Other HEK293T cells Dharmacon NucleoBond AX100 Macherey-Nagel (VWR) 740521 Dynabeads MyOne Streptavidin C1 magnetic beads ThermoFisher Scientific 65002 QUANTIFOIL® R 2/1 copper grids (200 mesh) EM Resolutions Ltd. QR21200Cu100 © The Author(s) The EMBO Journal 15 D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109.
Plasmid Preparation:Article Title: Determining the effects of pseudouridine incorporation on human tRNAs.
Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Recombinant DNA pETM30 expression vector Addgene Plasmid #133426 pETM11 expression vector Addgene Plasmid #108943 pFastBacHT A expression vector Invitrogen 10584027 Oligonucleotides and other sequence-based reagents GTCTCTGTGGCGCAATGGACGAGCGCGCTGGACT TCTAATCCAGAGGTTCCGGGTTCGAGTCCCGGCA GAGATG In house in vitro transcribed human tRNA Arg_TCT_4-1 GGTCCTCGTTAGTATAGTGGTGAGTATCCCCGCCT GTCACGCGGGAGACCGGGGTTCGATTCCCCGACG GGGAGCCA In house in vitro transcribed human tRNA Asp_GTC_2-1 GGCCCCATGGTGTAATGGTTAGCACTCTGGACTT TGAATCCAGCGATCCGAGTTCAAATCTCGGTGG GACCTCCA In house in vitro transcribed human tRNA Gln_TTG_3-1 GGTCCCTGGTGGTCTAGTGGCTAGGATTCGGCGC TTTCACCGCCGCGGCCCGGGTTCGATTCCCGGTC AGGGAACCA In house in vitro transcribed human tRNA Glu_TTC_4-1 12 The EMBO Journal © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent/Resource Reference or Source Identifier or Catalog Number Sodium bicarbonate, 1 M buffer soln., pH 10.0 ThermoFisher Scientific J63025.AK Chloroform Chempur CHEM*112344305-1L Triton X100 LabEmpire TRX777.100 Sodium deoxycholate Merck D6750-10G Sodium acetate VWR 0602-1KG Glycogen Merck 10901393001 BisTris HCl VWR 0715-100G [N-acryloylamino] phenyl) mercuric chloride (APM) Kind gift of Sebastian Leidel (University of Bern, Switzerland) IPTG AA Biotechnology 2003-25 Glycerol Chemland 08CL00C0724.01000 Protease K Merck P2308-10MG dNTP mix ThermoFisher Scientific R0192 ATP ThermoFisher Scientific R0441 CTP ThermoFisher Scientific R0451 GTP ThermoFisher Scientific R0461 UTP ThermoFisher Scientific R0471 Spermidine 0.1 M Merck 05292-1ML-F 5-Propargylamino-CTP-Cy5 Jena Bioscience NU-831-CY5 RNase‐free DNase I ThermoFisher Scientific 89836 RiboLock RNase Inhibitor ThermoFisher Scientific EO0382 pyrophosphatase ThermoFisher Scientific EF0221 HF buffer ThermoFisher Scientific F518L Phusion polymerase ThermoFisher Scientific R0461 T7 RNA polymerase Produced in house DMEM HG Lonza BE12-604F Trypsin-EDTA 0,25% Corning Diag-Med 25-053-CI PBS w/o Mg++ & Ca++ Lonza BE17-516F FBS EurX E5050-03 BL21 (DE3) CodonPlus-RIL competent cells ThermoFisher Scientific C600003 DH10Bac cells ThermoFisher Scientific 10361012 Hi5 insect cells ThermoFisher Scientific B85502 Sf9 (Expression Systems) insect cells ThermoFisher Scientific B82501 FuGENE® HD Transfection Reagent Promega E2311 Software PR.Panta Control software v1.4.4 NanoTemper Technologies PR-S061 AN.Control Software v1.1 NanoTemper Technologies AN-020001 OriginPro https://www.originlab.com/ OriginPro 2023 10.0.0.154 cryoSPARC Structura Biotechnology Inc. SimRNA https://genesilico.pl/software/stand-alone/simrna v3.2 Other HEK293T cells Dharmacon NucleoBond AX100 Macherey-Nagel (VWR) 740521 Dynabeads MyOne Streptavidin C1 magnetic beads ThermoFisher Scientific 65002 QUANTIFOIL® R 2/1 copper grids (200 mesh) EM Resolutions Ltd. QR21200Cu100 © The Author(s) The EMBO Journal 15 D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109.
Sequencing:Article Title: Determining the effects of pseudouridine incorporation on human tRNAs.
Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Recombinant DNA pETM30 expression vector Addgene Plasmid #133426 pETM11 expression vector Addgene Plasmid #108943 pFastBacHT A expression vector Invitrogen 10584027 Oligonucleotides and other sequence-based reagents GTCTCTGTGGCGCAATGGACGAGCGCGCTGGACT TCTAATCCAGAGGTTCCGGGTTCGAGTCCCGGCA GAGATG In house in vitro transcribed human tRNA Arg_TCT_4-1 GGTCCTCGTTAGTATAGTGGTGAGTATCCCCGCCT GTCACGCGGGAGACCGGGGTTCGATTCCCCGACG GGGAGCCA In house in vitro transcribed human tRNA Asp_GTC_2-1 GGCCCCATGGTGTAATGGTTAGCACTCTGGACTT TGAATCCAGCGATCCGAGTTCAAATCTCGGTGG GACCTCCA In house in vitro transcribed human tRNA Gln_TTG_3-1 GGTCCCTGGTGGTCTAGTGGCTAGGATTCGGCGC TTTCACCGCCGCGGCCCGGGTTCGATTCCCGGTC AGGGAACCA In house in vitro transcribed human tRNA Glu_TTC_4-1 12 The EMBO Journal © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent/Resource Reference or Source Identifier or Catalog Number Sodium bicarbonate, 1 M buffer soln., pH 10.0 ThermoFisher Scientific J63025.AK Chloroform Chempur CHEM*112344305-1L Triton X100 LabEmpire TRX777.100 Sodium deoxycholate Merck D6750-10G Sodium acetate VWR 0602-1KG Glycogen Merck 10901393001 BisTris HCl VWR 0715-100G [N-acryloylamino] phenyl) mercuric chloride (APM) Kind gift of Sebastian Leidel (University of Bern, Switzerland) IPTG AA Biotechnology 2003-25 Glycerol Chemland 08CL00C0724.01000 Protease K Merck P2308-10MG dNTP mix ThermoFisher Scientific R0192 ATP ThermoFisher Scientific R0441 CTP ThermoFisher Scientific R0451 GTP ThermoFisher Scientific R0461 UTP ThermoFisher Scientific R0471 Spermidine 0.1 M Merck 05292-1ML-F 5-Propargylamino-CTP-Cy5 Jena Bioscience NU-831-CY5 RNase‐free DNase I ThermoFisher Scientific 89836 RiboLock RNase Inhibitor ThermoFisher Scientific EO0382 pyrophosphatase ThermoFisher Scientific EF0221 HF buffer ThermoFisher Scientific F518L Phusion polymerase ThermoFisher Scientific R0461 T7 RNA polymerase Produced in house DMEM HG Lonza BE12-604F Trypsin-EDTA 0,25% Corning Diag-Med 25-053-CI PBS w/o Mg++ & Ca++ Lonza BE17-516F FBS EurX E5050-03 BL21 (DE3) CodonPlus-RIL competent cells ThermoFisher Scientific C600003 DH10Bac cells ThermoFisher Scientific 10361012 Hi5 insect cells ThermoFisher Scientific B85502 Sf9 (Expression Systems) insect cells ThermoFisher Scientific B82501 FuGENE® HD Transfection Reagent Promega E2311 Software PR.Panta Control software v1.4.4 NanoTemper Technologies PR-S061 AN.Control Software v1.1 NanoTemper Technologies AN-020001 OriginPro https://www.originlab.com/ OriginPro 2023 10.0.0.154 cryoSPARC Structura Biotechnology Inc. SimRNA https://genesilico.pl/software/stand-alone/simrna v3.2 Other HEK293T cells Dharmacon NucleoBond AX100 Macherey-Nagel (VWR) 740521 Dynabeads MyOne Streptavidin C1 magnetic beads ThermoFisher Scientific 65002 QUANTIFOIL® R 2/1 copper grids (200 mesh) EM Resolutions Ltd. QR21200Cu100 © The Author(s) The EMBO Journal 15 D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109.
In Vitro:Article Title: Determining the effects of pseudouridine incorporation on human tRNAs.
Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Recombinant DNA pETM30 expression vector Addgene Plasmid #133426 pETM11 expression vector Addgene Plasmid #108943 pFastBacHT A expression vector Invitrogen 10584027 Oligonucleotides and other sequence-based reagents GTCTCTGTGGCGCAATGGACGAGCGCGCTGGACT TCTAATCCAGAGGTTCCGGGTTCGAGTCCCGGCA GAGATG In house in vitro transcribed human tRNA Arg_TCT_4-1 GGTCCTCGTTAGTATAGTGGTGAGTATCCCCGCCT GTCACGCGGGAGACCGGGGTTCGATTCCCCGACG GGGAGCCA In house in vitro transcribed human tRNA Asp_GTC_2-1 GGCCCCATGGTGTAATGGTTAGCACTCTGGACTT TGAATCCAGCGATCCGAGTTCAAATCTCGGTGG GACCTCCA In house in vitro transcribed human tRNA Gln_TTG_3-1 GGTCCCTGGTGGTCTAGTGGCTAGGATTCGGCGC TTTCACCGCCGCGGCCCGGGTTCGATTCCCGGTC AGGGAACCA In house in vitro transcribed human tRNA Glu_TTC_4-1 12 The EMBO Journal © The Author(s) D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109. .. Reagent/Resource Reference or Source Identifier or Catalog Number Sodium bicarbonate, 1 M buffer soln., pH 10.0 ThermoFisher Scientific J63025.AK Chloroform Chempur CHEM*112344305-1L Triton X100 LabEmpire TRX777.100 Sodium deoxycholate Merck D6750-10G Sodium acetate VWR 0602-1KG Glycogen Merck 10901393001 BisTris HCl VWR 0715-100G [N-acryloylamino] phenyl) mercuric chloride (APM) Kind gift of Sebastian Leidel (University of Bern, Switzerland) IPTG AA Biotechnology 2003-25 Glycerol Chemland 08CL00C0724.01000 Protease K Merck P2308-10MG dNTP mix ThermoFisher Scientific R0192 ATP ThermoFisher Scientific R0441 CTP ThermoFisher Scientific R0451 GTP ThermoFisher Scientific R0461 UTP ThermoFisher Scientific R0471 Spermidine 0.1 M Merck 05292-1ML-F 5-Propargylamino-CTP-Cy5 Jena Bioscience NU-831-CY5 RNase‐free DNase I ThermoFisher Scientific 89836 RiboLock RNase Inhibitor ThermoFisher Scientific EO0382 pyrophosphatase ThermoFisher Scientific EF0221 HF buffer ThermoFisher Scientific F518L Phusion polymerase ThermoFisher Scientific R0461 T7 RNA polymerase Produced in house DMEM HG Lonza BE12-604F Trypsin-EDTA 0,25% Corning Diag-Med 25-053-CI PBS w/o Mg++ & Ca++ Lonza BE17-516F FBS EurX E5050-03 BL21 (DE3) CodonPlus-RIL competent cells ThermoFisher Scientific C600003 DH10Bac cells ThermoFisher Scientific 10361012 Hi5 insect cells ThermoFisher Scientific B85502 Sf9 (Expression Systems) insect cells ThermoFisher Scientific B82501 FuGENE® HD Transfection Reagent Promega E2311 Software PR.Panta Control software v1.4.4 NanoTemper Technologies PR-S061 AN.Control Software v1.1 NanoTemper Technologies AN-020001 OriginPro https://www.originlab.com/ OriginPro 2023 10.0.0.154 cryoSPARC Structura Biotechnology Inc. SimRNA https://genesilico.pl/software/stand-alone/simrna v3.2 Other HEK293T cells Dharmacon NucleoBond AX100 Macherey-Nagel (VWR) 740521 Dynabeads MyOne Streptavidin C1 magnetic beads ThermoFisher Scientific 65002 QUANTIFOIL® R 2/1 copper grids (200 mesh) EM Resolutions Ltd. QR21200Cu100 © The Author(s) The EMBO Journal 15 D ow nloaded from https://w w w .em bopress.org on M ay 1, 2025 from IP 103.47.133.109.
|
Addgene inc is a verified supplier 